::::

 

 

 

 

 

 
작성일 : 18-10-05 11:43
성명 및 업체명 : ***
 휴대폰 : ***-****-****
 제목 : Trilink RNA oligo 합성 견적문의 드립니다.--
 E-mail : *******@***.***
 주소 : [-] **************
RNA oligo를 합성할 예정입니다.

GGGAGAGCGGAAGCGUGCUGGGCCGGAGUUGAGGCGUAGAUGGUUCAGAUCCGAACGAUGAAGCAUAACCCAGAGGUCGAUGGAUCC

시퀀스는 이렇구요 87mer 입니다.
5`에 biotin을 3`에는 inverted dT를 modification 할 예정입니다.
scale은 가능한 scale 모두 알려주셨으면 좋겠습니다.

관리자 18-10-08 13:42
 
안녕하세요.

문의 감사합니다.

메일로 안내드리도록 하겠습니다.^^